Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Shown are 2 unrelated Amish pedigrees (pedigree 1 and pedigree 2) ( A ) with autopsy-negative sudden unexplained deaths or cardiac arrests. Open symbols (circles, women and girls; squares, men and boys) represent unaffected individuals. Black symbols represent affected family members. The age (in years) at sudden death is provided below the symbol representing sex. The yellow circles represent those family members whose iPSC-CMs were available for study. The red circle indicates the sudden death victim whose heart tissue was available for study. ( B ) A representative Sanger sequencing chromatogram from one of the RYR2-duplicated (RYR2 Dup) iPSC clones hosting the homozygous duplication and a graphical representation of the biallelic tandem 344,085 base pair (bp) duplication involving approximately 26,000 bp of intergenic sequence, RYR2 ’s 5′ UTR/promoter region, and exons 1–4 of RYR2 . ( C ) Bar graph illustrating the calculated copy number of RYR2 alleles in genomic DNA derived from patients known to be negative (WT, 2 copies), heterozygous (3 copies), or homozygous (4 copies) for the RYR2 duplication as well as confirmation of genotype in each control and mutant iPSC clone.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Sequencing, Clone Assay, Derivative Assay, Mutagenesis

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Shown is ( A ) real-time quantitative PCR (RT-qPCR) of RYR2 mRNA transcript normalized by cardiac troponin (cTnT) for 2 control donor heart tissue samples (control 1, a 42-year-old woman; and control 2, a 39-year-old man) and a heart tissue sample for a family member, a 12-year-old girl with sudden unexplained death in the young (SUDY) who was homozygous for the RYR2 duplication iPSC-CMs. Two independent RT-qPCR experiments with 6 technical replicates each ( N = 12) and ( B ) representative Western blots with RyR2 and cardiac α-actinin antibodies from the family member with SUDY and 2 unrelated control donor heart tissue samples (3 independent Western blots per sample). Shown are immunofluorescence (IF) images of a section of heart tissue collected from a relative with SUDY (pedigree 1, ) who died suddenly during exertion and a healthy 42-year-old female heart donor. ( C ) The individual IF images of RyR2 (red) and the cardiac marker cTnT (green) and the merged image along with DAPI staining for both the control and SUDY victim. ( D ) The individual IF images of the SR marker proteins calreticulin (green) and calsequestrin-2 (CASQ2, green) and the cardiac marker α-actinin (red) and the merged image along with DAPI staining for both the control and SUDY victim. Data are presented as mean ± SEM.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Immunofluorescence, Marker, Staining

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Shown are ( A ) screenshots of representative iPSC-CMs imaged and corresponding regions of interest used for calcium handling assessment and ( B ) representative raw tracings from unrelated WT (WT1) control iPSC-CMs and both patient human iPSC-CM lines (RYR2 Dup 1 clone 1 and clone 2 and RYR2 Dup 2 clone 1). Also shown are summary data bar graphs of ( C ) Fluo-4–measured calcium transient amplitude, normalized by (F – F0)/F0, ( D ) calcium transient decay 50% (τ), and ( E ) calcium transient time-to-peak values for (WT1 and WT2) control iPSC-CMs and both patient iPSC-CM lines (RYR2 Dup 1 clone 1 and clone 2 and RYR2 Dup 2 clone 1 and clone 2). Data are presented as mean ± standard deviation. n = 7 to 24 per group .

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Standard Deviation

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Representative Fluo-4–measured calcium transient before (blue trace) and after 100 nM ISO (red trace) are shown for ( A ) WT (WT1) control iPSC-CMs and ( B ) the homozygous RYR2 duplication iPSC-CMs for patient 1. ( C ) The average calcium transient amplitude summary data at baseline and after 100 nM ISO treatment for the WT1 and WT2 controls and both patient iPSC-CMs (2 clones each). Representative Fluo-4–measured calcium transients before and after 10 mM caffeine are shown for ( D ) WT1 control iPSC-CMs (blue trace) and the homozygous RYR2 duplication iPSC-CMs for patient 1 (red trace). ( E ) The average calcium transient amplitude summary data at baseline (BL) and after 10 mM caffeine (Caff) treatment for the WT1 and WT2 controls and both patient iPSC-CMs (2 clones each). Data are presented as mean ± SEM . A 2-tailed Student’s t test was performed to determine statistical significance between 2 groups. P < 0.05 was considered to be significant.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Clone Assay

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Representative action potential traces from ( A ) WT (WT1) control iPSC-CMs ( n = 10) and ( B ) RYR2 Dup 1-c2 mutant iPSC-CMs under baseline conditions ( n = 10) and ( C ) RYR2 Dup 1-c2 mutant ( n = 8) and ( D ) RYR2 Dup 2-c2 mutant ( n = 5) iPSC-CMs following ISO (100 nM) treatment. DAD events are indicated by the arrow.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Mutagenesis

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: ( A ) Representative field potential (FP) recordings from WT (WT1) and the homozygous RYR2 duplication iPSC-CMs for both patients (RYR2 Dup 1 and RYR2 Dup 2) at baseline (top) and following ISO (100 nM) treatment (bottom). ( B ) A bar graph summary showing the erratic beating frequency (i.e., arrhythmic events) present at baseline and following ISO treatment in WT1 iPSC-CMs compared with RYR2 duplication iPSC-CMs for both patients. WT1-iPSC-CM baseline ( n = 158, SEM = 1.25), WT-iPSC-CM ISO ( n = 160, SEM = 1.5), RYR2 Dup 1-c1-iPSC-CM baseline ( n = 165, SEM = 1.9), RYR2 Dup 1-c1-iPSC-CM ISO ( n = 419, SEM = 1.7), RYR2 Dup 2-c1-iPSC-CM baseline ( n = 129, SEM = 2.9), RYR2 Dup 2-c1-iPSC-CM ISO ( n = 100, SEM = 3.8). ( C ) Representative FP recordings from WT1 control and RYR2 duplication iPSC-CMs from patient 2 (RYR2 Dup 2 clone 1) at baseline, following ISO (100 nM) treatment alone, and following ISO with nadolol (10 μM). ( D ) A bar graph summary of the erratic beating frequency (i.e., arrhythmic events) present in WT1 iPSC-CMs compared with RYR2 duplication iPSC-CMs from patient 2 (RYR2 Dup 2 clone 1) at baseline, following ISO (100 nM) and in response to pharmacotherapies (nadolol at 10 μM, propranolol at 1 μM, and flecainide at 6 μM). Data are shown as number of experiments, where each experiment includes data acquired from 250–500 electrode recordings each. WT1-iPSC-CM baseline ( n = 4, SEM = 1.5), ISO ( n = 12, SEM = 0.4), ISO + nadolol ( n = 12, SEM = 0.20), ISO + propranolol ( n = 12, SEM = 0.20), and ISO + flecainide ( n = 12, SEM = 1.7). RYR2 Dup 2-c1-iPSC-CM baseline ( n = 4, SEM = 3.9), ISO ( n = 12, SEM = 1.5), ISO + nadolol ( n = 12, SEM = 1.1), ISO + propranolol ( n = 12, SEM = 0.72), and ISO + flecainide ( n = 12, SEM = 1.2). Data are presented as mean ± SEM. The symbol *** represents P < 0.0001. A 1-way ANOVA with Tukey’s test was performed to determine statistical significance between multiple groups. P < 0.05 was considered significant.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques:

Journal: Experimental & Molecular Medicine

Article Title: Unleashing the full potential of Hsp90 inhibitors as cancer therapeutics through simultaneous inactivation of Hsp90, Grp94, and TRAP1

doi: 10.1038/s12276-019-0360-x

Figure Lengend Snippet: a Calcineurin activity. HeLa cells were treated with drugs for 6 h. Calcineurin activity in total cell extracts was analyzed using a calcineurin phosphatase assay kit. Activity was expressed relative to that in DMSO-treated controls. b Suppression of Hsp70 by calcineurin silencing. Cells were treated for 24 h with control or calcineurin regulatory subunit (CNB) siRNAs, incubated for 6 h with drugs, and then analyzed by western blotting. c Effects of combined drug treatment in the absence of CNB. Cells were treated for 24 h with control or CNB siRNAs, incubated for 24 h with 5 μM gamitrinib and 10 μM DMAG, and then analyzed by the MTT assay. d Cytoplasmic calcium release. HeLa cells were stained with Fura-2AM after treatment for 6 h with 5 μM gamitrinib, 10 μM DMAG, and 10 μM PU-WS13 and then analyzed by fluorescence microscopy. Bar, 50 µm. e Fura-2AM staining after CypD knockdown. Control or CypD siRNA-transfected cells were treated for 6 h with 5 μM gamitrinib and 10 μM DMAG and then analyzed by fluorescence microscopy. f Fura-2AM staining after RyR2 knockdown. Control or RyR2 siRNA-transfected cells were treated for 6 h with 5 μM gamitrinib and 10 μM DMAG and then analyzed by fluorescence microscopy. g Hsp70 expression after CypD silencing. After treatment with control or CypD siRNAs, HeLa cells were incubated for 6 h with drugs and then analyzed by western blotting. h Hsp70 expression after RyR2 silencing. After treatment with control or RyR2 siRNAs, cells were incubated for 6 h with drugs and analyzed by western blotting. In a , c , the data are presented as the mean ± SEM; *** p < 0.001. In e , f , the data are presented as the mean ± SEM of two independent experiments and were collected from 40 cells; **** p < 0.0001.

Article Snippet: Small interfering RNAs (siRNA) specific for calcineurin, ryanodine receptor 2 (RyR2), cyclophilin D (CypD), TRAP1, and Grp94 were synthesized by Genolution (Korea). siRNAs targeting CypD and calcineurin regulatory subunit B (CNB) were synthesized by Genolution (Korea) using the following sequences: CNB-#1 5′-GCCTGAGTTACAACAGAATCCTTTA -3′ and CNB-#2 5′-GGAACAATCTGAAAGATACACAGTT-3′; RyR2-#1 5′-AAGTGGTTCTGCAGTGCACCG; RyR2-#2 5′-AAGTACGAGTTGGAGATGACC; CypD-#1 5′-GGCAGATGTCGT-CCCAAAG-3′ and CypD-#2 5′-GATAAGGGCTTCGGCTACA-3′; Grp94-#1 5′- TCGCCTCAGTTTGAACATTGA and Grp94-#2 5′- GAGAGAGGAAGAAGCTATT; TRAP1-#1 5′-AAACATGAGTTCCAGGCCGAG and TRAP1-#2 5′-CCCGGTCCCTGTACTCAGAAA; and control 5′-ACUCUAUCUGCACGCUGAC-3′.

Techniques: Activity Assay, Phosphatase Assay, Control, Incubation, Western Blot, MTT Assay, Staining, Fluorescence, Microscopy, Knockdown, Transfection, Expressing

Journal: Experimental & Molecular Medicine

Article Title: Unleashing the full potential of Hsp90 inhibitors as cancer therapeutics through simultaneous inactivation of Hsp90, Grp94, and TRAP1

doi: 10.1038/s12276-019-0360-x

Figure Lengend Snippet: a Structure of DN401. b Binding affinity of DN401 for full-length TRAP1, Hsp90, and GST-Grp94. Fluorescence polarization was measured using purified recombinant proteins and PU-H71-FITC3. The results were compared with maximum and minimum millipolarization (mP) values and presented as the mean ± SEM of two independent experiments. c Fluo-4 AM staining. HeLa cells were treated for 6 h with 10 μM gamitrinib, 20 μM DMAG, and 20 μM DN401. Fluo-4 AM-loaded HeLa cells were analyzed by flow cytometry (BD FACSCalibur™) by gating on living cells. d Calcineurin phosphatase activity. HeLa cells were treated for 6 h with 10 μM AUY922, 5 μM gamitrinib, 10 μM DMAG, 10 μM DN401, and 10 μM FK506. Calcineurin activity in total cell extracts was analyzed using calcineurin phosphatase assay kits. Activity is shown relative to that in DMSO-treated controls; data are presented as the mean ± SEM. e Effect of DN401 on HSF1 signaling. HeLa cells were treated for 24 h with control or CNB-#1 siRNA, incubated with drugs (10 μM) for 6 h and then analyzed by western blotting. f Calcineurin-mediated mitochondrial fragmentation. HeLa cells were treated for 24 h with control or calcineurin subunit B (CNB) siRNAs. MitoTracker-loaded HeLa cells were treated for 6 h with DMSO or 10 μM DN-401 and then analyzed by confocal microscopy. Bar, 5 μm. g Calcineurin-mediated cytotoxicity. HeLa cells were treated for 24 h with 10 μM DN401 in the presence of control, CNB-1, or CNB-2 siRNAs, stained with PI/Annexin V, and analyzed by flow cytometry (BD FACSCalibur™).

Article Snippet: Small interfering RNAs (siRNA) specific for calcineurin, ryanodine receptor 2 (RyR2), cyclophilin D (CypD), TRAP1, and Grp94 were synthesized by Genolution (Korea). siRNAs targeting CypD and calcineurin regulatory subunit B (CNB) were synthesized by Genolution (Korea) using the following sequences: CNB-#1 5′-GCCTGAGTTACAACAGAATCCTTTA -3′ and CNB-#2 5′-GGAACAATCTGAAAGATACACAGTT-3′; RyR2-#1 5′-AAGTGGTTCTGCAGTGCACCG; RyR2-#2 5′-AAGTACGAGTTGGAGATGACC; CypD-#1 5′-GGCAGATGTCGT-CCCAAAG-3′ and CypD-#2 5′-GATAAGGGCTTCGGCTACA-3′; Grp94-#1 5′- TCGCCTCAGTTTGAACATTGA and Grp94-#2 5′- GAGAGAGGAAGAAGCTATT; TRAP1-#1 5′-AAACATGAGTTCCAGGCCGAG and TRAP1-#2 5′-CCCGGTCCCTGTACTCAGAAA; and control 5′-ACUCUAUCUGCACGCUGAC-3′.

Techniques: Binding Assay, Fluorescence, Purification, Recombinant, Staining, Flow Cytometry, Activity Assay, Phosphatase Assay, Control, Incubation, Western Blot, Confocal Microscopy